[solved] – Question 91175

An example of a length 21 DNA string (whose alphabet contains the symbols ‘A’, ‘C’, ‘G’, and ‘T’) is “ATGCTTCAGAAAGGTCTTACG”…just use that in the answer)

Given: A DNA string s of length at most 1000 nt.

Write python code to return four integers (separated by spaces) counting the respective number of times that the symbols ‘A’, ‘C’, ‘G’, and ‘T’ occur in s.

Expert Answer

---