[solved]-Code Compiles Runs Output Searching Atg Tta Incorrect Please Help Find Wrong Q38995806

The code compiles and runs but the output when searching for ATGand TTA is incorrect. Please help find what is wrong.

3. [Bonus Problem] DNA Subsequence A DNA sequence is a sequence of some combination of the characters A (adenine), C (cytosine), G (guanine), and T (thymine) which correspond to the four nucleobases that make up DNA. Given a long DNA sequence, it is often necessary to compute the number of instances of a certain subsequence. For this exercise, you will develop a program that processes a DNA sequence from a file and, given a subsequences, searches the DNA sequence and counts the number of times s appears. As an example, consider the following sequence: GGAAGTAGCAGGCCGCATGCTTGGAGGTAAAGTTCATGGTTCCCTGGCCC If we were to search for the subsequence GTA, it appears twice. You will write a program (place your source in a file named dnaSearch.c) that takes, as command line inputs, an input file name and a valid DNA subsequence. That is, it should be callable from the command line as follows: ./dnaSearch dna01.txt GTA GTA appears 2 times What you will submit via handin: dnaSearch.c. 8 9 10 #include<stdio.h> #include <string.h> #include <stdlib.h> 12 int main( int argc, char *argv[]) { 14 15 16 18 19 ….char str[100], sub[10], string[1][100]; int i = 0, 1, 1, 11, 12, count = 0; char dest[100] = { 0 }; if( argc == 3){- …..printf(“n”); } else if ( argc > 3){- printf(“Too many arguments supplied. In”); …} …else { printf(“One argument expected. n”); 22 FILE *file = fopen( argv[1], “r”); … if ( file == 0 ) 28 printf(“Could not open filen”); 33 else . … fscanf( file, “%s”, str); //printf(“File Content: %sn”, str);- … fclose(file); strcpy(sub, argv[2]);- 11 = strlen(str); 12 = strlen( sub); while (i < 11) {- strncpy(dest, str+(i), 12);- ….. i++; 46 47 if(strcpy(dest, sub) == 0){ count++; cm .} printf(“%s occurs %d times n”, sub, count); return 0;- 49 50 } Show transcribed image text 3. [Bonus Problem] DNA Subsequence A DNA sequence is a sequence of some combination of the characters A (adenine), C (cytosine), G (guanine), and T (thymine) which correspond to the four nucleobases that make up DNA. Given a long DNA sequence, it is often necessary to compute the number of instances of a certain subsequence. For this exercise, you will develop a program that processes a DNA sequence from a file and, given a subsequences, searches the DNA sequence and counts the number of times s appears. As an example, consider the following sequence: GGAAGTAGCAGGCCGCATGCTTGGAGGTAAAGTTCATGGTTCCCTGGCCC If we were to search for the subsequence GTA, it appears twice. You will write a program (place your source in a file named dnaSearch.c) that takes, as command line inputs, an input file name and a valid DNA subsequence. That is, it should be callable from the command line as follows: ./dnaSearch dna01.txt GTA GTA appears 2 times What you will submit via handin: dnaSearch.c.
8 9 10 #include #include #include 12 int main( int argc, char *argv[]) { 14 15 16 18 19 ….char str[100], sub[10], string[1][100]; int i = 0, 1, 1, 11, 12, count = 0; char dest[100] = { 0 }; if( argc == 3){- …..printf(“n”); } else if ( argc > 3){- printf(“Too many arguments supplied. In”); …} …else { printf(“One argument expected. n”); 22 FILE *file = fopen( argv[1], “r”); … if ( file == 0 ) 28 printf(“Could not open filen”); 33 else . … fscanf( file, “%s”, str); //printf(“File Content: %sn”, str);- … fclose(file); strcpy(sub, argv[2]);- 11 = strlen(str); 12 = strlen( sub); while (i

Expert Answer

---

Answer to The code compiles and runs but the output when searching for ATG and TTA is incorrect. Please help find what is wrong…. . . .