[solved] – Question 91037
1.Students at a local middle school volunteered to sell fresh baked cookies to raise funds to increase the number of computers for the computer lab. Each student reported the number of boxes he/she sold.Write program for the above statement.
2.Write a program that will ask as input the number of volunteers, the name of the volunteer, and the number of boxes sold by the volunteer. the the program produces as output the total number
Expert Answer
[solved] – Question 9104
I`ve created my first webapplication. I set up my webserver (tomcat+apache2) and tried to deploy the app on it. When I tested the app it worked fine with my test environment, but when created the war and deployed it the following error (exception) showed up:
description The server encountered an internal error () that prevented it from fulfilling this request.
exception
org.apache.jasper.JasperException: Unable to compile class for JSP:
An error occurred at line: 14 in the generated java file Only a type can be imported. bitcoin.BitcoinHandler resolves to a package
An error occurred at line: 16 in the jsp file: /Balance.jsp BitcoinHandler cannot be resolved 13: double yourcoins=0.0; 14: Random rand=new Random(); 15:
16: balance=new Double(BitcoinHandler.getBalance(“give”)); 17:
18:
19: if(balance>2.5)
What can I do about this.. I tried different IDEs to comiple it best for my webserver.. !??
Expert Answer
[solved] – Question 91048
Can you tell me the logic why you assign pointer pa with names of array and how 1d pointer is working as 2d like storing and accessing values (can you tell me back end programming)
Expert Answer
[solved] – Question 91136
Roots clothing company business model for scarf, sweater , shirts and pants.
Expert Answer
[solved] – Question 91167
Write a C++ program that initializes an array with numbers {-1, 5, 6, 18, 19, 25, 46, 78, 102, 114} and
then uses a binary search to locate for the position of any number input to the program. Display an
appropriate message in case the number in not located
Expert Answer
[solved] – Question 91175
An example of a length 21 DNA string (whose alphabet contains the symbols ‘A’, ‘C’, ‘G’, and ‘T’) is “ATGCTTCAGAAAGGTCTTACG”…just use that in the answer)
Given: A DNA string s of length at most 1000 nt.
Write python code to return four integers (separated by spaces) counting the respective number of times that the symbols ‘A’, ‘C’, ‘G’, and ‘T’ occur in s.
Expert Answer
[solved] – Question 91178
Consider the following statements. Explain why some statements fail and correct the errors. In the case of no error give the correct answer.
a. x=1; print ‘sin(%g)=%g’ % (x, sin(x))
b. C=A+B; A=3; B=2; print C
c. C=21.0; F=9.*(C/5.0)+32; print F
d. t=(2, 4, 6, ‘temp.pdf’); t[1]=4; print t
Expert Answer
[solved] – Question 91179
1. What is the result of the expression shown below if x = 56.236?
print(“%.2f”%x)
a)56.00
b)56.24
c)56.23
d)0056.236
2. What is the output of the following?
x = [‘ab’, ‘cd’]
for i in x:
i.upper()
print (x)
a)[‘ab’, ‘cd’]
b)[‘AB’, ‘CD’]
c)[None, None]
d)none of the mentioned
Expert Answer
[solved] – Question 91181
1. What will be the result of print W?
s=[“apples”, “bananas”, “carrots]
W=[len(w) for w in s]
2. What is the output of print “hello”+1+2+3
3. What gets printed?
name = “snow storm”
name[5] = ‘X’
print name
Expert Answer
[solved] – Question 91182
1. What gets printed?
while a = 10:
print(‘Howdy’)
2. What is printed by the python code?
Print 14/4, 14%4, 14.0/4
3. What is printed by the python code?
print ‘2’ + ‘3’
4. What is printed by the Python code?
for i in range(4):
print (i)
5. Given a string s, write a short expression for a string that includes s repeated five times.
Expert Answer
