[solved]-Using The Codon Wheel And The Following Mrna Sequence Below Answer The Following Questions Guaaugaaacgccugguagaagguugaugc 1 List The Dna Strand Sequence From Which The Mrna Was Transcribed 2 42075

Using the codon wheel and the following mRNA sequencebelow, answer the following questions:GUAAUGAAACGCCUGGUAGAAGGUUGAUGC1. List the DNA strand sequence from which the mRNA wastranscribed:2. List the complementary DNA sequence to the above DNAstrand:3. List the tRNA sequence that is complementary to themRNA strand above:4. Using the codon wheel, list the amino acid sequenceof the protein coded for by the original mRNAsequence:5. a) What would be the effect of changing base 4 to aG? b) What would the effect be if base 6 was changed to aG? c) What would be the effect of changing base 16 to aU?d) What would happen if base 7 was deleted?e) What would the new amino acid sequencebe?

Expert Answer

---

. . .